u2os arl8 double knockout dko cell line generation (Addgene inc)
Addgene inc is a verified supplier 
96
Structured Review
Addgene inc
u2os arl8 double knockout dko cell line generation
U2os Arl8 Double Knockout Dko Cell Line Generation, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2928 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+arl8+double+knockout+dko+cell+line+generation/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pmc12992710-360-0-15
Average 96 stars, based on 2928 article reviews
U2os Arl8 Double Knockout Dko Cell Line Generation, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 2928 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/u2os+arl8+double+knockout+dko+cell+line+generation/pSpCas9(BB)-2A-Puro+(PX459)+V2%2E0+(Plasmid+%2362988)/pmc12992710-360-0-15
Average 96 stars, based on 2928 article reviews
u2os arl8 double knockout dko cell line generation - by Bioz Stars,
2026-09
96/100 stars
Images
Related Articles
Double Knockout:Article Title: Control of lysosome function by the GTPase-activating protein TBC1D9B and its binding partner TMEM55B Article Snippet: The knock-in was additionally validated by Sanger sequencing and Synthego analysis tool ( https://design.synthego.com/#/validate ) analysis with the following Primers: amplification: CCGACTGGTGCATCTCCTTT and GAGAGCCTGTAATGCTAGGCAG sequencing: GAGAGCCTGTAATGCTAGGCAG. .. U2OS ARL8 double knockout (DKO) cell line generation : pSpCas9( |